Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: Cytosolic mislocalization is a prerequisite for SG recruitment of TDP-43. A, shown is a schematic diagram of TDP-43 wild-type (WT) and NLS mutant (NLSmut). NLSmut, triple point mutation in the classical nuclear localization signal (K83A/R84A/K85A); G-rich, glycine-rich domain; V5, V5 epitope tag. B, C-terminal-V5-tagged TDP-WT or NLSmut were transiently transfected into HeLa cells and 24 h later were subjected to heat shock (44 °C for 1 h), sodium arsenite (0.5 mm for 30 min), or clotrimazole (20 μm for 30 min) treatment or were left untreated (Control). Cells were fixed, stained with a V5 (green) and TIA-1 (red)-specific antibody and a nuclear counterstain (blue), and analyzed by confocal microscopy. Panels to the right show a higher magnification of the boxed region. Although the cytosolic NLS mutant was sequestered into SG, TDP-WT remained nuclear under all stress conditions examined. Scale bars = 20 μm. C, primary rat hippocampal neurons were transiently transfected with V5-tagged TDP-WT or NLSmut. 48 h post-transfection, neurons were subjected to heat shock (44 °C) for 1 h or left untreated (37 °C). Neurons were fixed and stained with a V5-specific antibody (green), a TIA-1-specific antibody (red), and the neuronal marker antibody Tuj1 (white) to visualize neuronal morphology. NLSmut showed partial cytoplasmic mislocalization and was recruited to TIA-1-positive SG upon heat stress. Insets in the upper right corner show a higher magnification of the boxed region. Scale bars, 20 μm.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, Transfection, Staining, Confocal Microscopy, Marker

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: Endogenous TDP-43 is sequestered into heat shock-induced SG upon inhibition of Importin α/β-dependent nuclear import. HeLa cells were transfected with an Importin α/β-specific peptide inhibitor fused to GFP (GFP-Bimax) or GFP as a control (green). 24 h post-transfection cells were subjected to heat shock (44 °C for 1 h) or kept at control temperature (37 °C) before fixation. Cells were co-stained for endogenous TDP-43 (red) and TIA-1 (white) and analyzed by confocal microscopy. Expression of GFP-Bimax resulted in cytosolic mislocalization of endogenous TDP-43 and recruitment into SG upon heat shock. Under control conditions (GFP), TDP-43 was predominantly nuclear and did not colocalize with SG after heat shock. Scale bars = 20 μm.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Inhibition, Transfection, Staining, Confocal Microscopy, Expressing

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: ALS-associated TARDBP mutations do not alter the cellular localization of TDP-43. A, Myc-tagged wild-type TDP-WT or TDP-43 carrying the indicated ALS-associated point mutations (A315T, M337V, or G348C) were transiently transfected into HeLa cells. 24 h post-transfection cells were subjected to heat shock (44 °C for 1 h) or kept at control temperature (37 °C). Afterward cells were fixed, stained with a myc (green) and TIA-1 (red)-specific antibody and a nuclei counterstain (blue), and analyzed by confocal microscopy. Both TDP-WT and the ALS-associated point mutants were nuclear under control conditions and remained nuclear upon heat shock. Scale bars = 20 μm. B, shown are expression levels of TDP-43 constructs used in A. Total cell lysates were analyzed by immunoblotting with a myc-specific antibody (upper panel). Tubulin served as a loading control (lower panel). All lanes were from the same exposure of the same blot. C, quantification of nuclear and cytosolic fluorescence intensities of myc staining at 37 °C is shown. Error bars indicate S.D.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Transfection, Staining, Confocal Microscopy, Expressing, Construct, Western Blot, Fluorescence

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: ALS-associated TARDBP mutations do not affect SG recruitment of cytosolic TDP-43. ALS-associated point mutations (A315T, M337V, G348C) were introduced into the TDP-43 NLS mutant (NLSmutA315T, NLSmutM337V, NLSmutG348C), and the effect of mutations on SG recruitment was analyzed. A, HeLa cells transiently transfected with the indicated TDP-43 constructs were incubated with clotrimazole for 30 min or left untreated (Control). Cells were fixed, stained with a V5 (green) and TIA-1 (red)-specific antibody and a nuclear counterstain (blue), and analyzed by confocal microscopy. ALS-associated point mutations did not affect SG recruitment of cytosolic TDP-43. Scale bars = 20 μm. B, protein levels in total cell lysates were analyzed by immunoblotting with a V5-specific antibody (upper panel), and tubulin served as a loading control (lower panel). The black arrowhead indicates full-length TDP-43, and the white arrowhead indicates caspase-generated 35-kDa CTF frequently observed under transient transfection conditions (61, 75). C, the percentage of TDP-43 localized in TIA-1-positive SG was quantified using ImageJ. 15–20 cells were analyzed in a blinded manner, means across all cells were calculated, and S.D. are indicated by error bars.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, Transfection, Construct, Incubation, Staining, Confocal Microscopy, Western Blot, Generated

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: TDP-43 inclusions in spinal cord but not hippocampus are frequently co-labeled for the SG marker protein PABP-1. TDP-43 immunohistochemistry performed on formalin-fixed, paraffin-embedded tissue sections of spinal cord (upper panels) or hippocampus (lower panels) from FTLD-TDP and ALS-TDP cases is shown. Staining with N-terminal and C-terminal TDP-43-specific antibodies demonstrated labeling of neuronal cytoplasmic inclusions in motor neurons in the spinal cord with both antibodies (ALS case #1 shown), whereas inclusions in dentate granule neurons in the hippocampus were labeled only with the C-terminal antibody (FTLD-TDP case #1 shown). Double-label immunofluorescence stainings of the same cases showed co-labeling of phospho-TDP-43 positive inclusions (green) with the SG marker protein PABP-1 (red) in the spinal cord but not in cortical inclusions. Nuclei were stained with DAPI (blue). Scale bars = 10 μm.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Labeling, Marker, Immunohistochemistry, Formalin-fixed Paraffin-Embedded, Staining, Immunofluorescence

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: 25 kDa C-terminal fragment and a C-terminal deletion mutant of TDP-43 are poorly sequestered into SG. A, shown is a schematic diagram of TDP-43 deletion mutants analyzed for SG recruitment. The deletion mutant Δ1–173 was chosen to mimic the 25-kDa CTF found to be deposited in cortical regions of FTLD-TDP patients (4, 59). The C-terminal deletion mutant (NLSmutΔC) lacks the prion-like glycine-rich domain. B, the indicated TDP-43 constructs were transiently transfected in HeLa cells. Before fixation, cells were treated with clotrimazole (20 μm, 30 min) or left untreated (control). Subsequently, cells were stained with a V5 (green) and TIA-1 (red)-specific antibody and a nuclear counterstain (blue) and analyzed by confocal microscopy. Panels to the right show a higher magnification of the boxed region. In contrast to full-length TDP-NLSmut, both deletion mutants remained predominantly diffuse in the cytosol upon heat shock and were poorly recruited to SG. Scale bars = 20 μm. C, the percentage of TDP-43 localized in TIA-1-positive SG was quantified using ImageJ. 15–20 cells were analyzed in a blinded manner, means across all cells were calculated, and S.D. are indicated by error bars. D, protein levels in total cell lysates were analyzed by immunoblotting with a V5-specific antibody (upper panel); tubulin served as a loading control (lower panel). Black arrowheads indicate full-length TDP-NLSmut or the two deletion mutants, and white arrowheads indicate degradation products. All lanes were from the same exposure of the same blot.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, Construct, Transfection, Staining, Confocal Microscopy, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: The C-terminal deletion mutant of TDP-43 still binds to UG12 RNA. A, TDP-WT was in vitro translated in the presence of [35S]methionine (left lane, Input) and was analyzed for binding to different RNA oligonucleotides immobilized on streptavidin beads (right lanes, UG12, UGUGUGUGUGUGUGUGUGUGUGUG; GGUG, UUGUAUUUUGAGCUAGUUUGGUGAU; CCUC, UUGUAUUUUGAGCUAGUUUCCUCAU). TDP-43 bound to both UG12 and GGUG RNA but not to CCUC RNA). B, the indicated TDP-43 constructs were in vitro translated in the presence of [35S]methionine (upper panel, Input). Biotinylated UG12 RNA or CCUC control RNA were immobilized on streptavidin beads and were used to pull down radioactively labeled proteins (lower panel, Pulldown). TDP-WT and NLSmut as well as the C-terminal deletion mutant NLSmut-ΔC were specifically pulled down by UG12 RNA, whereas the Δ1–173 deletion mutant resembling the 25-kDa CTF did not bind to UG12 RNA.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, In Vitro, Binding Assay, Construct, Labeling

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: Model of SG recruitment of TDP-43 and FUS. Upon cellular stress, translation of mRNAs is arrested and translationally silent preinitiation complexes that contain mRNA, the small ribosomal subunit (40 S), early initiation factors (e.g. eIF3, eIF4A, eIF4G), and PABP-1 are packaged into SG. We suggest that recruitment of TDP-43 (left) or FUS (right) into SG involves both protein-RNA and protein-protein interactions. TDP-43 and FUS bind to UG-rich mRNA sequences via their main RNA binding domain (RRM1 in TDP-43 and RGG-zinc finger (Z) domain in FUS, respectively) and thus might be recruited into SG via their associated mRNAs. Because additional domains that did not show binding to UG-rich RNA in our RNA binding assay also contribute to SG recruitment of TDP-43 and FUS, we suggest that additional protein-protein interactions with proteins X and Y are involved in SG recruitment of TDP-43 and FUS.

Article Snippet: The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: RNA Binding Assay, Binding Assay

Journal: mAbs

Article Title: Targeted protein degradation through site-specific antibody conjugation with mannose 6-phosphate glycan

doi: 10.1080/19420862.2024.2415333

Figure Lengend Snippet: TNF internalization mediated by bisM6P-anti-tnf. (a) In vitro experimental scheme. (b) Staining of TNF complex labeled with Alexa Fluor™ 647 in K562 and Jurkat cells, which were treated with biotinylated TNF (50 nM) and streptavidin labeled with Fluor™ 647 (100 nM) complex and 25 nM of anti-tnf or bisM6P-anti-tnf (~4 bisM6P per antibody) for 1 hr, as measured by flow cytometry. The fold increase in MFI (mean fluorescence intensity) represents the MFI of TNF staining from cells treated by bisM6P-anti-tnf divided by that of anti-tnf control. Six experiments were performed with K562 (singlet for Experiments 1 and 3: shown means. Duplicate for Experiment 2 and triplicate for Experiments 4, 5, and 6: shown means ± SDs). Five experiments were performed with Jurkat (singlet for Experiment 2: shown means. Duplicate for Expreiment 1 and triplicate for Experiments 3, 4, and 5: shown means ± SDs) (c) K562 or Jurkat cells were incubated with TNF complexes (biotinylated TNF at 50 nM and streptavidin labeled with Alexa Fluor™ 488 at 100 nM) and unconjugated or bisM6P-conjugated anti-tnf antibody (green) at 75 nM for 1 or 3 hrs at 37°C as indicated, followed by DAPI staining to visualize nuclei (blue). For T0 samples in the left bottom column, K562 cells were incubated with complexes of unconjugated or bisM6P-conjugated anti-tnf antibody (green) at 75 nM at 4°C for 30 minutes. Jurkat cells were also stained with fluorescent WGA to label the cell surface. (d) K562 or Jurkat cells were incubated with unconjugated or bisM6P-conjugated anti-tnf antibody complexes (~4 bisM6P per antibody) (green) at 75 nM for 3 hrs as indicated. Cells were then stained with DAPI (blue) and antibodies against early endosomal marker EEA1 (magenta) and lysosomal marker LAMP1 (red). Samples were imaged at 40× using confocal microscopy (left hand panels) or at 100× using super resolution microscopy (middle and right-hand panels). 3D reconstructions of the super-resolved data are shown for both K562 (middle panels) and Jurkat (right panels) along with individual image planes in which the EEA1 and LAMP1 channels are shown separately as indicated. Representative images were shown from 3 experiments.

Article Snippet: In some experiments, permeabilized samples were stained with antibodies against Early Endosome Antigen 1 (EEA1) (clone F.43.1, Invitrogen) and Lysosome-Associated Membrane Protein 1 (LAMP1) (clone H4A3, ProteinTech) to allow for evaluation of subcellular targeting to early endosomes and lysosomes, respectively.

Techniques: In Vitro, Staining, Labeling, Flow Cytometry, Fluorescence, Control, Incubation, Marker, Confocal Microscopy, Super-Resolution Microscopy

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Active immunization does not affect pTDP-43 levels and TDP-43 cytoplasmic-to-nuclear distribution in rNLS8 mice. Cerebral TDP-43 pathology was analyzed by ELISA, immunohistochemistry, and immunofluorescence stainings in vaccinated rNLS8 mice. A Phospho-TDP-43 (pS409/410) levels were measured in RIPA and urea fractions from neocortex. Only monogenic animals showed statistically significant differences in RIPA lysates (ctrl PBS: p = 7.63*10 –5 , ctrl VAX: p = 7.63*10 –5 ) and urea lysates (ctrl PBS: p = 7.70*10 –5 , ctrl VAX: p = 7.70*10 –5 ) when compared to TDP-PBS group by pairwise Wilcoxon test with Benjamini–Hochberg correction. Mean values are plotted as black dots. B Immunohistochemical staining in the hippocampal region using an antibody against pS409/410 TDP-43. Representative images for each group are shown. Magnified insets are displayed on the top right corner and their position in the overview is depicted by dashed rectangles. Arrows in the inset denote characteristic pTDP-43 inclusions in the CA3 region. Scale bar overview = 500 µm, scale bar inset = 50 µm. C: Immunofluorescence staining of total TDP-43 (human + mouse) in the frontal neocortex. Representative images for each group are depicted in the left panel (Scale bar = 20 µm). Note that control PBS images were taken at a higher gain to compensate for the lower levels of endogenous TDP-43. Right panel shows quantification of the ratios of the cytoplasmic-to-nuclear TDP-43 intensities (after normalization to the ctrl PBS group). Mean values are plotted as black dots. Pairwise t-test with Benjamini–Hochberg correction indicated a statistically significant difference between monogenic ctrl PBS and bigenic TDP-PBS animals ( p = 3.32*10 –5 ). Control (ctrl) PBS n = 6, TDP-PBS n = 6, TDP5 + 7 n = 5, TDP8 + 9 n = 6, TDP10 + 12 n = 5, and TDP15 n = 6

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Enzyme-linked Immunosorbent Assay, Immunohistochemistry, Immunofluorescence, Immunohistochemical staining, Staining, Control

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Epitope scan of TDP-43 reveals differential immunogenicity and safety in mice. Active immunization with 15 different TDP-43 peptides in wild-type C57BL/6J to select the most immunogenic ones for therapeutic vaccination in rNLS8 mice. A Localization and relative size of peptides used for active immunization targeting human TDP-43. Peptide 15 contains pS409/410. NTD: N-terminal domain, NLS: Nuclear localization signal, RRM1/2: RNA recognition motif 1/2. B Immunization regimen for wild-type C57BL/6J mice (age in weeks). Two mice per peptide antigen were immunized monthly (i1-i3) with serum collected before and in between immunizations (b0-b3). C Antibody response towards human recombinant TDP-43 (left panel) or pTDP-43 peptide (pS409/410, right panel) was determined by ELISA after three immunizations. Background-corrected optical density at 450 nm (OD450) was measured in duplicates for each animal (dots) with bars representing mean values. All sera were diluted 1:500. Preimmune serum is analyzed in Fig. S1B. D Experimental groups for therapeutic vaccination. rNLS8 animals expressing hTDP-43ΔNLS were immunized with either pooled antigens or PBS control. Monogenic littermates received either PBS (ctrl PBS) or a mixture of all peptides used for rNLS8 immunization (ctrl VAX). Peptides 1 and 3 were excluded from the control group after discovering side effects in the TDP1 + 3 group (Fig. 1F). E Timeline of immunization and blood sampling in rNLS8 and control mice. After the fifth blood sampling (b5), hTDP-43∆NLS expression was induced by removing doxycycline (DOX) from the chow. All mice were sacrificed 21 days after transgene induction (28.5 weeks of age). F Kaplan–Meier plot showing survival probability of mice during study (humane endpoint). Number of animals at the beginning of the immunization regimen is indicated. Log-rank test and pairwise comparisons with Benjamini–Hochberg correction revealed a statistically significant higher mortality in TDP1 + 3 immunized compared to TDP-PBS control mice (*, p = 0.039). Note that immunization of surviving TDP1 + 3 mice was discontinued after 1, 2 or 3 immunizations ( # , dashed line)

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Expressing, Control, Sampling

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: C-terminal TDP-43 peptides elicit high-titer antibodies detecting patient TDP-43 aggregates. TDP-43-specific antibody responses in sera from mice receiving five immunizations (expect TDP1 + 3 with 1–3 immunizations) were analyzed by ELISA, immunofluorescence stainings, and immunoblot. A A dilution series of pooled sera was analyzed by ELISA against recombinant full-length TDP-43 (left panel) or pTDP-43 peptide (pS409/410, right panel). Background-corrected mean OD450 was measured in duplicates. Triangular shapes indicate monogenic animals, circles represent rNLS8 mice (labeling consistent throughout the following figures). B Antibody response in antisera from individual mice was measured as in ( A ) in single dilutions (1:500 or 1:20,000) to analyze inter-animal variability. Control (ctrl) PBS n = 17, ctrl VAX n = 18, TDP-PBS n = 10, TDP1 + 3 n = 3, TDP5 + 7 n = 13, TDP8 + 9 n = 13, TDP10 + 12 n = 12, and TDP15 n = 12. Note that the number of immunizations in TDP1 + 3 animals (1, 2 or 3) correlates with the resulting titer. C Double immunofluorescence stainings of pooled antisera and phosphorylated TDP-43 (pS409/410) were performed on frontal cortex sections of a sporadic FTLD case. Representative images are shown. Arrowheads indicate strong (TDP10 + 12, TDP15) or weak (TDP1 + 3, TDP8 + 9) labeling of pTDP-43 inclusions with antisera. TDP5 + 7 antiserum failed to detect pTDP-43-positive inclusions (open arrowhead). Images from a healthy control are shown in Fig. S3A. Scale bar = 10 µm. D Immunoblotting of HEK293 cell lysates of doxycycline-inducible TARDBP knockdown (KD) and control (ctrl) using a commercial TDP-43 antibody (left lane) or pooled antisera. Asterisk denotes a prominent non-specific band detected with the ctrl PBS serum. Calnexin was used as a loading control

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Enzyme-linked Immunosorbent Assay, Immunofluorescence, Western Blot, Recombinant, Labeling, Control, Knockdown

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: TDP-43 active immunization does not prevent weight loss, but the pTDP-43 antigen moderately lowers NfL. Body weight and NfL levels were analyzed in immunized control and rNLS8 mice. A Development of body weight in control and rNLS8 mice before and after transgene induction using doxycycline withdrawal. Mean values are plotted group-wise, n as indicated. The longitudinal effects of treatment (peptide immunization vs. no immunization), genotype (control vs. rNLS8), age as well as their interactions were analyzed using a three-way repeated measures ANOVA. On doxycycline chow, only age had a statistically significant effect on the body weight ( p = 1.99*10 –102 ), but not the treatment ( p = 0.74). After transgene induction, genotype ( p = 0.018), age ( p = 2.34*10 –26 ), and their interaction ( p = 2.20*10 –26 ), but not treatment ( p = 0.901), had a statistically significant effect on the body weight. B Comparison of the percentage body weight (BW) loss from transgene induction (25.5 weeks of age) to end-stage (28.5 weeks of age) against the TDP-PBS group using pairwise t-test with Benjamini–Hochberg correction revealed a statistically significant difference for both monogenic groups (ctrl PBS vs. TDP-PBS: p = 1.47*10 –11 , ctrl VAX vs. TDP-PBS: p = 6.38*10 –10 ) only. Group means are indicated as black dots. C Neurofilament light chain (NfL) levels in the serum of end-stage mice were quantified using the Simoa® platform. Comparisons against TDP-PBS mice using pairwise Wilcoxon test with Benjamini–Hochberg correction revealed a statistically significant difference in NfL levels for ctrl PBS ( p = 8.3*10 –7 ), ctrl VAX ( p = 8.3*10 –7 ), and TDP15 immunized mice ( p = 0.013). Mean values are indicated as black dots

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Control, Comparison

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Profound micro- and astrogliosis in the rNLS8 model are unchanged upon vaccination with TDP-43 peptides. Using an automated staining and analysis pipeline, microglia (Iba1) and astrocyte (GFAP) signals were quantified in hippocampal regions. Representative immunofluorescence images of Iba1 ( A ) or GFAP ( B )-stained hippocampal regions. Magnified insets are shown on the top right corner and their position in the overview is indicated by dashed rectangles. Scale bar overview = 500 µm, scale bar inset = 50 µm. Right panels show automated quantification of the Iba1 ( A ) and GFAP ( B ) cell count per area, followed by normalization to the ctrl PBS group. Mean values are plotted as black dots. Pairwise Wilcoxon test with Benjamini–Hochberg correction revealed an increased Iba1 count in the TDP-PBS group when compared to ctrl PBS animals ( p = 0.011). GFAP counts were analyzed using pairwise t-test with Benjamini–Hochberg correction and were statistically different between TDP-PBS and ctrl PBS mice ( p = 2.04*10 –5 ). None of the vaccinated groups are significantly different from TDP-PBS. Control (ctrl) PBS n = 6, TDP-PBS n = 6, TDP5 + 7 n = 6, TDP8 + 9 n = 6, TDP10 + 12 n = 5, and TDP15 n = 5

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Staining, Immunofluorescence, Cell Counting, Control

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Antibodies targeting RRM2 and the glycine-rich region of TDP-43 suppress aggregation and LLPS in vitro . A Schematic overview of a panel of novel TDP-43 monoclonal antibodies (mAbs) raised from immunization in Fig. as indicated. The most potent mAbs are highlighted in bold. B Aggregation and condensation assays using recombinant TDP-43-MBP-His 6 . Upon cleavage of the solubilization tag maltose-binding protein (MBP) using TEV protease, soluble TDP-43 forms aggregates ( C ) or condensates ( D / E ), depending on the buffer conditions. Condensates were either analyzed by pelleting ( D ) or by confocal microscopy ( E ). mAbs were added to soluble TDP-43-MBP-His 6 together with TEV protease. C Representative images of Alexa 488-labeled and in vitro aggregated TDP-43, treated with the indicated mAb (molar ratio TDP-43-MBP-His 6 : mAb = 1:2). Images were taken 48 h after TEV cleavage. Clones 30D3 and 31E9 nearly completely prevented aggregation. Overview and magnified insets on the right bottom corner are shown. Scale bar overview = 100 µm, scale bar inset = 50 µm. D Sedimentation assay to analyze condensation of cleaved TDP-43-MBP-His 6 in the presence of mAbs. Supernatant (S) and condensates (C) were separated by centrifugation 2 h after TEV cleavage. Representative immunoblots and quantification of S/(C + S) ratios (bar graphs indicate mean + SD) from four replicates are shown. An asterisk indicates the residual uncleaved TDP-43-MBP-His 6 , the arrowhead marks the cleaved TDP-43 band. mAbs were compared to their respective isotype controls using pairwise t-test with Benjamini–Hochberg correction for multiple testing: IgG2c vs. 30D3: p = 0.017; IgG2c vs. 36C5: p = 3.24*10 –4 ; IgG2c vs. 36C10: p = 0.016; IgG1 vs. 27A3: p = 0.021; IgG1 vs. 31E9: p = 3.87*10 –4 . E Confocal images of Alexa 488-coupled TDP-43-MBP-His 6 and DyLight 650-labeled mAbs show liquid–liquid phase separation of TDP-43 and co-partitioning of mAbs with TDP-43 condensates after TEV protease cleavage. Scale bar = 10 µm

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: In Vitro, Recombinant, Binding Assay, Confocal Microscopy, Labeling, Clone Assay, Sedimentation, Centrifugation, Western Blot

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: TDP-43 mAbs suppress cellular uptake of recombinant TDP-43 aggregates. A Overview of TDP-43 uptake assay. Aggregation of pHrodo Green-labeled TDP-43-MBP-His 6 was induced by TEV protease cleavage and thorough shaking for 30 min, followed by a 2 h incubation step at room temperature. Preformed aggregates were then incubated with mAbs for 30 min before addition to SH-SY5Y cells. Upon cellular uptake via endocytosis, the pHrodo-tagged aggregates show increased fluorescence in acidic compartments, such as early endosomes (EE), and, even more so, in late endosomes (LE) or lysosomes. After 24 h of incubation, pHrodo fluorescence was analyzed by flow cytometry in the FITC channel. B Representative flow cytometry dot plots showing uptake of pHrodo-TDP-43 agg in combination with different control or TDP-43 specific mAbs in SH-SY5Y cells. Data areshown as relative fluorescence in the FITC channel (x-axis) and side scatter (SSC-A, y-axis). Relevant comparisons are overlaid. Cells were pregated to identify live singlets (not shown). Vertical dotted lines indicate gating for pHrodo + live singlets. C Quantification of TDP-43 aggregate uptake in SH-SY5Y cells, measured as percentage of pHrodo-positive cells of total live single cells. Bar graphs represent mean + SD from n = 3–4 independent experiments. The following comparisons revealed statistically significant differences after pairwise t-test with Benjamini–Hochberg correction: pHrodo-TDP-43 agg + IgG1 ctrl vs. pHrodo-TDP-43 agg + 31E9 (G1): p = 0.037; pHrodo-TDP-43 agg + IgG2c ctrl vs. pHrodo-TDP-43 agg + 36C10 (G2c): p = 0.023; non-treated vs. pHrodo-TDP-43 agg : p = 0.023; pHrodo-TDP-43 mono vs. pHrodo-TDP-43 agg : p = 0.023; TDP-43 agg vs. pHrodo-TDP-43 agg : p = 0.023; pHrodo-TDP-43 agg vs. pHrodo-TDP-43 agg (22 °C): p = 0.023

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Recombinant, Labeling, Incubation, Fluorescence, Flow Cytometry, Control

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Specific binding of anti-T-cadherin antibodies to megakaryocytes MEG-01 and platelets compared with negative THP-1 control and positive human umbilical vein endothelial cells (HUVEC) control according to flow cytometry data. Forward scatter /Side scatter gates were cell specific and channel voltage for detection of T-cadherin (ex640 em670/14) was the same for all cells (THP-1, HUVEC, MEG-01) and different for platelets. ( a ) Distribution histograms of cells incubated with antibodies anti-T-cadherin (blue) or isotypic control (red). ( b ) Median and percentiles of the fluorescence (antibody binding) for the above histograms. * The binding of the specific antibody is greater than of the isotype control, p < 0.001. n = 5. ( c ) Median and percentiles of the fluorescence (antibody binding) for blank sample without antibody (Bl), sample with rabbit IgG (IG_R), ProSci (PS), SantaCruz (SC), and Abnova (Ab) antibodies. * The binding of the specific antibody is greater than of the isotype control, p < 0.001. n = 2.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Binding Assay, Flow Cytometry, Incubation, Fluorescence

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Validation of antibody #BAF3264. Fixed cells. Hoechst 33342 (DNA)—blue, #BAF3264 (T-cadherin)—red: ( a ) Wild-type CHO; ( b ) CHO cells with T-cadherin expression. Scale bar (red line) 10 µm.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Expressing

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Representative confocal microscopy image (a single focal plane) of T-cadherin on platelets. CD61—green, T-cadherin—red, DNA (Hoecst 33342)—blue. Live platelet and nucleated blood cells. Scale bar (white line) 2 µm.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Confocal Microscopy

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Digestion with phosphatidylinositol-specific phospholipase C (PI-PLC) decreases binding of the specific antibody against T-cadherin to platelets ( a ) and MEG-01 ( b ). Platelets are identified by their FSC/SSC characteristic (the first gate) and positive CD61 labeling (the second gate), MEG-01 cells are identified by the other FSC/SSC gate. Right histograms show fluorescence from the binding of the anti-T-cadherin antibody before (blue) and after (red) PI-PLC treatment and from the isotypic control (gray).

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Binding Assay, Labeling, Fluorescence

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Representative immunoblots against T-cadherin with platelet and positive controls lysates with protein bands standards, n = 5. ( a ) First three lanes were incubated with R&D #AF3264 antibodies, last three lanes were incubated with ProSci #3583 antibodies, H–HUVEC, pl1, pl2—platelets from different donors, HT–HEK293 overexpressing T-cadherin (preparation describe in ) (film), ( b ) H–HUVEC, pl—immunoprecipitate of the platelet lysate (R&D #AF3264, multichannel digital detection).

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Western Blot, Incubation

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Analysis of fractions after ultracentrifugation of platelet lysates with the Triton X-114 detergent. 1–12—the fractions obtained after ultracentrifugation. Upper panel—immunoblotting of the obtained fractions with antibodies against T-cadherin. The middle panel shows the total amount of protein in the fractions, analyzed using amide black. The lower panel shows the ratio of the T-cadherin signal intensity measured by immunoblotting to the total protein amount in the fractions, arbitrary units.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Western Blot

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: The confocal microscopy images and orthogonal view of Z-stack of resting and activated platelets. CD61—green, T-cadherin—red. Plots of fluorescence intensity along the cross-section line from ( a , b ), respectively. ( a ) Fixed resting human platelets—non-permeabilized (left) and permeabilized (right); ( b ) fixed and permeabilized activated human platelet; ( c ) live activated human platelet. Scale bar (white line) 2 µm.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Confocal Microscopy, Fluorescence

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 decreases ubiquitination of Cx43 in rats exposed to CUS. The tissue lysates immunopreciptated using normal rabbit IgG or rabbit antibody against total Cx43 (IP: Cx43). The immune complexes immunoblotted using an antibody against ubiquitin (IB: Ubiquitin). The blots from three independent experiments were subjected to densitometric analyses for ubiquitinated Cx43 and the results were expressed as the density of the bands in the test sample relative to those in the vehicle sample. n = 3 per group. ** p < 0.01, compared with the vehicle group; # p < 0.05, compared with the CUS group. Cx43, connexin 43.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Ubiquitin Proteomics

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 decreases ubiquitinated Cx43 in CUS-treated rats. The confocal microscopy images showed double-stained with antibodies against Cx43 (green) and ubiquitin (red). Nuclei are stained with DAPI. Scale bar = 150 μm. n = 3 per group. ** p < 0.01, compared with the vehicle group; # p < 0.05, compared with the CUS group. Ubi, ubiquitin.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Confocal Microscopy, Staining, Ubiquitin Proteomics

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 suppresses the increased Cx43 ubiquitin degradation in LPS-induced glial cells. The cell lysates were subjected to immunoprecipitation with anti-Cx43 antibody (IP: Cx43) or normal IgG. The resultant precipitates were then subjected to western blot using anti-ubiquitin antibody (IB: Ubiquitin). Quantification of the ubiquitinated Cx43 was expressed as percentages of the control values. n = 3. ** p < 0.01, compared with the Ctrl group; # p < 0.01, compared with the LPS group.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Ubiquitin Proteomics, Immunoprecipitation, Western Blot, Control

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 reduces ubiquitinated Cx43 in LPS-treated glial cells. The confocal microscopy images showed double-stained with antibodies against Cx43 (green) and ubiquitin (red). Nuclei were labeled with blue. Scale bar = 150 μm. n = 3. ** p < 0.01, compared with the Ctrl group; # p < 0.05, compared with the LPS group.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Confocal Microscopy, Staining, Ubiquitin Proteomics, Labeling

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Schematic illustration of the signaling pathway involved in the anti-inflammatory and anti-depressant actions of Rg1 on Cx43 ubiquitination. Stresses, such as CUS or LPS treatment upregulates pro-inflammatory cytokines activation, which in turn aggravates depression. Rg1 may ameliorate neuroinflammation via suppression of Cx43 ubiquitination to attenuate depression.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Ubiquitin Proteomics, Activation Assay